vm04084, vm04084 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namevm04084
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)11
Primer 1vm04084.forward primer: GGATTCTCACTCTGATACCATT
Primer 2vm04084.reverse primer: GAACGATACACAACGAAGGT
Product Length153
Max Length196
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2007LG3N/A89.4vm04084View
2Cranberry-Mullica_Queen-2007LG3N/A108.4vm04084View
3Cranberry-Mullica_Queen-2017LG03N/A102.4vm04084View
4Cranberry-CNJ02-1-2007LG3N/A99.02vm04084View
5Cranberry-CNJ02-1-2017LG03N/A93.6vm04084View
6Cranberry-Crimson_Queen-2017LG03N/A84.6vm04084View
7Cranberry-[BG//BL/BN]95-F1LG03N/A8.54vm04084View
8Cranberry-Composite_map-F1LG03N/A6.52vm04084View
9Cranberry-Crimson_Queen-F1LG03N/A1.79vm04084View
10Cranberry-GH1/35-F1LG03N/A4.55vm04084View
11Cranberry-Mullica_Queen_1-F1LG03N/A7.15vm04084View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primervm04084.forward primerVaccinium macrocarponprimer
reverse primervm04084.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
vm04084vm04084Vaccinium macrocarponmarker_locus
vm04084vm04084-8.54Vaccinium macrocarponmarker_locus
vm04084vm04084-6.52Vaccinium macrocarponmarker_locus
vm04084vm04084-1.79Vaccinium macrocarponmarker_locus
vm04084vm04084-4.55Vaccinium macrocarponmarker_locus
vm04084vm04084-7.15Vaccinium macrocarponmarker_locus