vm13780, vm13780 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namevm13780
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)13
Primer 1vm13780.forward primer: CCTTCTGCTGGACACTCATA
Primer 2vm13780.reverse primer: ACCCATACCAGAGGAGTACATA
Product Length167
Max Length177
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2007LG2N/A1.25vm13780View
2Cranberry-Mullica_Queen-2007LG2N/A2.9vm13780View
3Blueberry-F1#10_x_W85-23-F1-2017LG02N/A0vm13780View
4Blueberry-W85-23-2017LG02N/A0vm13780View
5Cranberry-CNJ02-1-2017LG02N/A0vm13780View
6Cranberry-Mullica_Queen-2017LG02N/A0vm13780View
7Cranberry-Composite_map-F1LG02N/A100.75vm13780View
8Cranberry-Mullica_Queen_1-F1LG02N/A112.64vm13780View