vm89040, vm89040 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namevm89040
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)13
Primer 1vm89040.forward primer: TAGACAGACTTTCATGCTATGG
Primer 2vm89040.reverse primer: GAACTGATGAAGGTGGTTTATC
Product Length232
Max Length240
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-CNJ02-1-2007LG1N/A6.71vm89040ViewN/A
2Blueberry-W85-23-2017LG01N/A0vm89040ViewN/A
3Cranberry-Mullica_Queen-2017LG01N/A7.3vm89040ViewN/A
4Cranberry-Crimson_Queen-2007LG1N/A4.1vm89040ViewN/A
5Blueberry-F1#10-2017LG01N/A4.8vm89040ViewN/A
6Blueberry-F1#10_x_W85-23-F1-2017LG01N/A3.6vm89040ViewN/A
7Cranberry-Crimson_Queen-2017LG01N/A4.1vm89040ViewN/A
8Cranberry-CNJ02-1-2017LG01N/A6.7vm89040ViewN/A
9Cranberry-Composite_map-F1LG01N/A108.1vm89040ViewN/A
10Cranberry-Crimson_Queen-F1LG01N/A75.72vm89040ViewN/A
11Cranberry-Mullica_Queen_1-F1LG01N/A99.2vm89040ViewN/A
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primervm89040.forward primerVaccinium macrocarponprimer
reverse primervm89040.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
vm89040vm89040Vaccinium macrocarponmarker_locus
vm89040vm89040-108.1Vaccinium macrocarponmarker_locus
vm89040vm89040-75.72Vaccinium macrocarponmarker_locus
vm89040vm89040-99.2Vaccinium macrocarponmarker_locus