NCSU_Chr01_10289137

Marker Overview
NameNCSU_Chr01_10289137
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
5' Flanking SequenceACTACATGAAGCAGGTTCCGATCCCCACCCACCGCGGTTCCGTTATCCCTTTTACCTCGT GGACTGGATTATCCAAATCCATTAAGCAGTTATATGGCCA
3' Flanking SequenceCCACTGCATTACCTCACCAACATTCTCCTAAACCAGTGGGACAAAATGAGAATTGGCTGT GAGGATGAAGATGTACCATTGGACACCCTTATTCATCCTT
SpeciesVaccinium corymbosum
Publication[view all]
ContactMassimo Iorizzo
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Blueberry-Reveille/Arlen-F1LG01N/A21.58Chr01_10289137View
2Blueberry-Reveille/Arlen-F1-2022LG01N/A30.12Chr01_10289137View
Sequence
>NCSU_Chr01_10289137 ID=NCSU_Chr01_10289137; Name=NCSU_Chr01_10289137; organism=Vaccinium corymbosum; type=genetic_marker; length=201bp
ACTACATGAAGCAGGTTCCGATCCCCACCCACCGCGGTTCCGTTATCCCT
TTTACCTCGTGGACTGGATTATCCAAATCCATTAAGCAGTTATATGGCCA
RCCACTGCATTACCTCACCAACATTCTCCTAAACCAGTGGGACAAAATGA
GAATTGGCTGTGAGGATGAAGATGTACCATTGGACACCCTTATTCATCCT
T
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
VaccDscaff1supercontigVaccDscaff1:8059806..8059806 .
Vcev1_p0.Chr01supercontigVcev1_p0.Chr01:10289137..10289137 .
Contact
NameDetails
Massimo Iorizzo
First name:Massimo
Last name:Iorizzo
Institution:North Carolina State University
Address:Kannapolis, NC, United States
Country:United States
Email:miorizz@ncsu.edu
Last update:Aug 2021
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Chr01_10289137Chr01_10289137Vaccinium corymbosummarker_locus