scaffold_111040, scaffold_111040 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescaffold_111040
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scaffold_111040.Forward primer: ACACAGTTTATGCAGAGCTTAC
Primer 2scaffold_111040.Reverse Primer: ATCTCTCTCTCTCTCTTTGAGC
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Composite_map-F1LG12N/A9.82scaffold_111040View
2Cranberry-Crimson_Queen-F1LG12N/A4.76scaffold_111040View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerscaffold_111040.Forward primerVaccinium macrocarponprimer
Reverse Primerscaffold_111040.Reverse PrimerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scaffold_111040scaffold_111040-9.82Vaccinium macrocarponmarker_locus
scaffold_111040scaffold_111040-4.76Vaccinium macrocarponmarker_locus