scaffold_11617, scaffold_11617 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescaffold_11617
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scaffold_11617.Forward primer: TCTCTCTTCTCTCTCACTTTCC
Primer 2scaffold_11617.Reverse Primer: TATCCGCTATCTCATCCTTTAG
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Composite_map-F1LG07N/A4.76scaffold_11617View
2Cranberry-Mullica_Queen_1-F1LG07N/A4.76scaffold_11617View
3Cranberry-Crimson_Queen-F1LG07N/A5.95scaffold_11617View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerscaffold_11617.Forward primerVaccinium macrocarponprimer
Reverse Primerscaffold_11617.Reverse PrimerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scaffold_11617scaffold_11617-4.76Vaccinium macrocarponmarker_locus
scaffold_11617scaffold_11617-5.95Vaccinium macrocarponmarker_locus