scaffold_11771, scaffold_11771 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescaffold_11771
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scaffold_11771.Forward primer: GAGATCAGAGAGGAGTAGTTGG
Primer 2scaffold_11771.Reverse Primer: ATAAGGGAGAGTTGGTATAGGA
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Composite_map-F1LG10N/A72.58scaffold_11771View
2Cranberry-Crimson_Queen-F1LG10N/A69.14scaffold_11771View
3Cranberry-Mullica_Queen_1-F1LG10N/A83.67scaffold_11771View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerscaffold_11771.Forward primerVaccinium macrocarponprimer
Reverse Primerscaffold_11771.Reverse PrimerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scaffold_11771scaffold_11771-72.58Vaccinium macrocarponmarker_locus
scaffold_11771scaffold_11771-69.14Vaccinium macrocarponmarker_locus
scaffold_11771scaffold_11771-83.67Vaccinium macrocarponmarker_locus