scaffold_120214, scaffold_120214 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescaffold_120214
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scaffold_120214.Forward primer: GTGGACCTCGACTATCATTATT
Primer 2scaffold_120214.Reverse Primer: TTCAAATACTCCTGCTGACTAC
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Composite_map-F1LG04N/A32.91scaffold_120214View
2Cranberry-Crimson_Queen-F1LG04N/A36.9scaffold_120214View
3Cranberry-Mullica_Queen_1-F1LG04N/A56.66scaffold_120214View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerscaffold_120214.Forward primerVaccinium macrocarponprimer
Reverse Primerscaffold_120214.Reverse PrimerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scaffold_120214scaffold_120214-32.91Vaccinium macrocarponmarker_locus
scaffold_120214scaffold_120214-36.9Vaccinium macrocarponmarker_locus
scaffold_120214scaffold_120214-56.66Vaccinium macrocarponmarker_locus