scaffold_13275, scaffold_13275 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescaffold_13275
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scaffold_13275.Forward primer: AGGAAGAGTGATATTAGCGGT
Primer 2scaffold_13275.Reverse Primer: GAGTATGTGTTTTGGTTGTGG
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Composite_map-F1LG03N/A60.96scaffold_13275View
2Cranberry-Crimson_Queen-F1LG03N/A59.22scaffold_13275View
3Cranberry-Mullica_Queen_1-F1LG03N/A78.09scaffold_13275View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerscaffold_13275.Forward primerVaccinium macrocarponprimer
Reverse Primerscaffold_13275.Reverse PrimerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scaffold_13275scaffold_13275-60.96Vaccinium macrocarponmarker_locus
scaffold_13275scaffold_13275-59.22Vaccinium macrocarponmarker_locus
scaffold_13275scaffold_13275-78.09Vaccinium macrocarponmarker_locus