scaffold_19017, scaffold_19017 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescaffold_19017
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scaffold_19017.Forward primer: GACTACTCTTGTCTTCGATTGG
Primer 2scaffold_19017.Reverse Primer: GTATCAAAATCTCTCTTGGGC
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Composite_map-F1LG03N/A74.7scaffold_19017View
2Cranberry-Mullica_Queen_1-F1LG03N/A98.06scaffold_19017View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerscaffold_19017.Forward primerVaccinium macrocarponprimer
Reverse Primerscaffold_19017.Reverse PrimerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scaffold_19017scaffold_19017-74.7Vaccinium macrocarponmarker_locus
scaffold_19017scaffold_19017-98.06Vaccinium macrocarponmarker_locus