scaffold_19017, scaffold_19017 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	scaffold_19017
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Primer 1	scaffold_19017.Forward primer: GACTACTCTTGTCTTCGATTGG
Primer 2	scaffold_19017.Reverse Primer: GTATCAAAATCTCTCTTGGGC
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr03	supercontig	Vmac_chr03:5608123..5608412 .
chr3	supercontig	chr3:5653304..5653593 .
Chr08	supercontig	Chr08:5122170..5122471 .

Publications


Year	Publication
2017	Schlautman B, Covarrubias-Pazaran G, Diaz-Garcia L, Iorizzo M, Polashock J, Grygleski E, Vorsa N, Zalapa J. Construction of a High-Density American Cranberry (Vaccinium macrocarpon Ait.) Composite Map Using Genotyping-by-Sequencing for Multi-pedigree Linkage mapping. G3 (Bethesda, Md.). 2017 Mar 01.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-Composite_map-F1	LG03	N/A	74.7	scaffold_19017	View
2	Cranberry-Mullica_Queen_1-F1	LG03	N/A	98.06	scaffold_19017	View