scaffold_21777, scaffold_21777 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescaffold_21777
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scaffold_21777.Forward primer: GATGCTCTCTCTTTCAATTAGG
Primer 2scaffold_21777.Reverse Primer: TTTAGGTCTTGGGTAGCACTAT
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Composite_map-F1LG10N/A50scaffold_21777View
2Cranberry-Crimson_Queen-F1LG10N/A50.68scaffold_21777View
3Cranberry-Mullica_Queen_1-F1LG10N/A51.89scaffold_21777View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerscaffold_21777.Forward primerVaccinium macrocarponprimer
Reverse Primerscaffold_21777.Reverse PrimerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scaffold_21777scaffold_21777-50Vaccinium macrocarponmarker_locus
scaffold_21777scaffold_21777-50.68Vaccinium macrocarponmarker_locus
scaffold_21777scaffold_21777-51.89Vaccinium macrocarponmarker_locus