scaffold_24341, scaffold_24341 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescaffold_24341
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scaffold_24341.Forward primer: CTGTTTCAGGTTAGCATTGAG
Primer 2scaffold_24341.Reverse Primer: GAGTTTTGCAGTAGCTCTAGGT
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Composite_map-F1LG04N/A32.32scaffold_24341View
2Cranberry-Crimson_Queen-F1LG04N/A36.9scaffold_24341View
3Cranberry-Mullica_Queen_1-F1LG04N/A56.07scaffold_24341View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerscaffold_24341.Forward primerVaccinium macrocarponprimer
Reverse Primerscaffold_24341.Reverse PrimerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scaffold_24341scaffold_24341-32.32Vaccinium macrocarponmarker_locus
scaffold_24341scaffold_24341-36.9Vaccinium macrocarponmarker_locus
scaffold_24341scaffold_24341-56.07Vaccinium macrocarponmarker_locus