scaffold_26291, scaffold_26291 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescaffold_26291
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scaffold_26291.Forward primer: GCCTGTACGATCTTTATCTTCT
Primer 2scaffold_26291.Reverse Primer: TAAAACACTCACCACCCTCTA
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Composite_map-F1LG01N/A76.43scaffold_26291View
2Cranberry-Mullica_Queen_1-F1LG01N/A63.44scaffold_26291View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerscaffold_26291.Forward primerVaccinium macrocarponprimer
Reverse Primerscaffold_26291.Reverse PrimerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scaffold_26291scaffold_26291-76.43Vaccinium macrocarponmarker_locus
scaffold_26291scaffold_26291-63.44Vaccinium macrocarponmarker_locus