scaffold_31246, scaffold_31246 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescaffold_31246
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scaffold_31246.Forward primer: GGGATATTACACACACACACAC
Primer 2scaffold_31246.Reverse Primer: AGGAGAGAGAGTACCAGTCTTTT
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Composite_map-F1LG03N/A60.96scaffold_31246View
2Cranberry-Mullica_Queen_1-F1LG03N/A78.68scaffold_31246View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerscaffold_31246.Forward primerVaccinium macrocarponprimer
Reverse Primerscaffold_31246.Reverse PrimerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scaffold_31246scaffold_31246-60.96Vaccinium macrocarponmarker_locus
scaffold_31246scaffold_31246-78.68Vaccinium macrocarponmarker_locus