scaffold_3314, scaffold_3314 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescaffold_3314
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scaffold_3314.Forward primer: CAGATTAAGGAAAAGGAGAAGG
Primer 2scaffold_3314.Reverse Primer: AAAGACCAACCTAGTCCACATA
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Composite_map-F1LG04N/A62.26scaffold_3314View
2Cranberry-Crimson_Queen-F1LG04N/A64.93scaffold_3314View
3Cranberry-Mullica_Queen_1-F1LG04N/A87.69scaffold_3314View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerscaffold_3314.Forward primerVaccinium macrocarponprimer
Reverse Primerscaffold_3314.Reverse PrimerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scaffold_3314scaffold_3314-62.26Vaccinium macrocarponmarker_locus
scaffold_3314scaffold_3314-64.93Vaccinium macrocarponmarker_locus
scaffold_3314scaffold_3314-87.69Vaccinium macrocarponmarker_locus