scaffold_35862, scaffold_35862 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescaffold_35862
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scaffold_35862.Forward primer: GGAAGATAGAAAACACGACAAG
Primer 2scaffold_35862.Reverse Primer: GATGATTACCCTCCTCTCTCAT
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Composite_map-F1LG03N/A87.55scaffold_35862View
2Cranberry-Crimson_Queen-F1LG03N/A86.65scaffold_35862View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerscaffold_35862.Forward primerVaccinium macrocarponprimer
Reverse Primerscaffold_35862.Reverse PrimerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scaffold_35862scaffold_35862-87.55Vaccinium macrocarponmarker_locus
scaffold_35862scaffold_35862-86.65Vaccinium macrocarponmarker_locus