scaffold_37951, scaffold_37951 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescaffold_37951
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scaffold_37951.Forward primer: TTCTGGGTTCCATTACCATA
Primer 2scaffold_37951.Reverse Primer: CTTGTTCTCTATCCTCTTCAGC
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Composite_map-F1LG03N/A30.23scaffold_37951View
2Cranberry-Crimson_Queen-F1LG03N/A33.59scaffold_37951View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerscaffold_37951.Forward primerVaccinium macrocarponprimer
Reverse Primerscaffold_37951.Reverse PrimerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scaffold_37951scaffold_37951-30.23Vaccinium macrocarponmarker_locus
scaffold_37951scaffold_37951-33.59Vaccinium macrocarponmarker_locus