scaffold_18380, scaffold_18380 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescaffold_18380
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scaffold_18380.Forward primer: CAACCACATAACGCACTACTAT
Primer 2scaffold_18380.Reverse Primer: TGGAGTGATACTTGGTCTCC
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Composite_map-F1LG01N/A52.06scaffold_18380View
2Cranberry-Crimson_Queen-F1LG01N/A32.78scaffold_18380View
3Cranberry-Mullica_Queen_1-F1LG01N/A34.58scaffold_18380View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerscaffold_18380.Forward primerVaccinium macrocarponprimer
Reverse Primerscaffold_18380.Reverse PrimerVaccinium macrocarponprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Titratable acidityqTA.CNJ02-1.LG01Vaccinium macrocarponQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scaffold_18380scaffold_18380-52.06Vaccinium macrocarponmarker_locus
scaffold_18380scaffold_18380-32.78Vaccinium macrocarponmarker_locus
scaffold_18380scaffold_18380-34.58Vaccinium macrocarponmarker_locus