scaffold_42843, scaffold_42843 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescaffold_42843
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scaffold_42843.Forward primer: TTTCTCCATCTCTCTCTTATCC
Primer 2scaffold_42843.Reverse Primer: ACTCACTGTTCACCTTCTCTG
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Composite_map-F1LG12N/A17.15scaffold_42843View
2Cranberry-Crimson_Queen-F1LG12N/A9.54scaffold_42843View
3Cranberry-Mullica_Queen_1-F1LG12N/A17.89scaffold_42843View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerscaffold_42843.Forward primerVaccinium macrocarponprimer
Reverse Primerscaffold_42843.Reverse PrimerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scaffold_42843scaffold_42843-17.15Vaccinium macrocarponmarker_locus
scaffold_42843scaffold_42843-9.54Vaccinium macrocarponmarker_locus
scaffold_42843scaffold_42843-17.89Vaccinium macrocarponmarker_locus