scaffold_48237, scaffold_48237 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	scaffold_48237
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Primer 1	scaffold_48237.Forward primer: CTCTCTGCTGTTTTCATCAAC
Primer 2	scaffold_48237.Reverse Primer: GCTATTAAGGAAGGGTCAAAC
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr08	supercontig	Vmac_chr08:21879662..21880021 .

Publications


Year	Publication
2017	Schlautman B, Covarrubias-Pazaran G, Diaz-Garcia L, Iorizzo M, Polashock J, Grygleski E, Vorsa N, Zalapa J. Construction of a High-Density American Cranberry (Vaccinium macrocarpon Ait.) Composite Map Using Genotyping-by-Sequencing for Multi-pedigree Linkage mapping. G3 (Bethesda, Md.). 2017 Mar 01.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-Composite_map-F1	LG08	N/A	51.81	scaffold_48237	View
2	Cranberry-Crimson_Queen-F1	LG08	N/A	37.6	scaffold_48237	View
3	Cranberry-Mullica_Queen_1-F1	LG08	N/A	67.82	scaffold_48237	View