scaffold_48237, scaffold_48237 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescaffold_48237
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scaffold_48237.Forward primer: CTCTCTGCTGTTTTCATCAAC
Primer 2scaffold_48237.Reverse Primer: GCTATTAAGGAAGGGTCAAAC
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Composite_map-F1LG08N/A51.81scaffold_48237View
2Cranberry-Crimson_Queen-F1LG08N/A37.6scaffold_48237View
3Cranberry-Mullica_Queen_1-F1LG08N/A67.82scaffold_48237View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerscaffold_48237.Forward primerVaccinium macrocarponprimer
Reverse Primerscaffold_48237.Reverse PrimerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scaffold_48237scaffold_48237-51.81Vaccinium macrocarponmarker_locus
scaffold_48237scaffold_48237-37.6Vaccinium macrocarponmarker_locus
scaffold_48237scaffold_48237-67.82Vaccinium macrocarponmarker_locus