scaffold_50168, scaffold_50168 (genetic_marker) Vaccinium macrocarpon

Name	scaffold_50168
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Primer 1	scaffold_50168.Forward primer: CGTTCCAAAATAAGCGTCT
Primer 2	scaffold_50168.Reverse Primer: CATCTGCCTAATATAACTGGGT
Publication	[view all]

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-Composite_map-F1	LG08	N/A	51.74	scaffold_50168	View
2	Cranberry-Crimson_Queen-F1	LG08	N/A	37.6	scaffold_50168	View

Year	Publication
2017	Schlautman B, Covarrubias-Pazaran G, Diaz-Garcia L, Iorizzo M, Polashock J, Grygleski E, Vorsa N, Zalapa J. Construction of a High-Density American Cranberry (Vaccinium macrocarpon Ait.) Composite Map Using Genotyping-by-Sequencing for Multi-pedigree Linkage mapping. G3 (Bethesda, Md.). 2017 Mar 01.

This genetic_marker is adjacent to the following primer feature(s):

Feature Name	Unique Name	Species	Type
Forward primer	scaffold_50168.Forward primer	Vaccinium macrocarpon	primer
Reverse Primer	scaffold_50168.Reverse Primer	Vaccinium macrocarpon	primer

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature Name	Unique Name	Species	Type
scaffold_50168	scaffold_50168-51.74	Vaccinium macrocarpon	marker_locus
scaffold_50168	scaffold_50168-37.6	Vaccinium macrocarpon	marker_locus