scaffold_50168, scaffold_50168 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescaffold_50168
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scaffold_50168.Forward primer: CGTTCCAAAATAAGCGTCT
Primer 2scaffold_50168.Reverse Primer: CATCTGCCTAATATAACTGGGT
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Composite_map-F1LG08N/A51.74scaffold_50168View
2Cranberry-Crimson_Queen-F1LG08N/A37.6scaffold_50168View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerscaffold_50168.Forward primerVaccinium macrocarponprimer
Reverse Primerscaffold_50168.Reverse PrimerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scaffold_50168scaffold_50168-51.74Vaccinium macrocarponmarker_locus
scaffold_50168scaffold_50168-37.6Vaccinium macrocarponmarker_locus