scaffold_51535, scaffold_51535 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescaffold_51535
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scaffold_51535.Forward primer: GACCAATCAGAATTAGACAACG
Primer 2scaffold_51535.Reverse Primer: GTTCGTGAAAATAGGAGTACGA
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Composite_map-F1LG04N/A62.26scaffold_51535View
2Cranberry-Crimson_Queen-F1LG04N/A64.93scaffold_51535View
3Cranberry-Mullica_Queen_1-F1LG04N/A87.69scaffold_51535View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerscaffold_51535.Forward primerVaccinium macrocarponprimer
Reverse Primerscaffold_51535.Reverse PrimerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scaffold_51535scaffold_51535-62.26Vaccinium macrocarponmarker_locus
scaffold_51535scaffold_51535-64.93Vaccinium macrocarponmarker_locus
scaffold_51535scaffold_51535-87.69Vaccinium macrocarponmarker_locus