scaffold_5180, scaffold_5180 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescaffold_5180
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scaffold_5180.Forward primer: CTCTCTTACTTTCCACTGTTCC
Primer 2scaffold_5180.Reverse Primer: CTCTATCCTCTTCAACACCACT
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Composite_map-F1LG04N/A62.26scaffold_5180View
2Cranberry-Crimson_Queen-F1LG04N/A64.93scaffold_5180View
3Cranberry-Mullica_Queen_1-F1LG04N/A88.28scaffold_5180View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerscaffold_5180.Forward primerVaccinium macrocarponprimer
Reverse Primerscaffold_5180.Reverse PrimerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scaffold_5180scaffold_5180-62.26Vaccinium macrocarponmarker_locus
scaffold_5180scaffold_5180-64.93Vaccinium macrocarponmarker_locus
scaffold_5180scaffold_5180-88.28Vaccinium macrocarponmarker_locus