scaffold_38278, scaffold_38278 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescaffold_38278
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scaffold_38278.Forward primer: TGTATCTTTGATCTGTACGGG
Primer 2scaffold_38278.Reverse Primer: TTCGGGTTAGAGTTTAGTAGGA
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Composite_map-F1LG02N/A28.18scaffold_38278View
2Cranberry-Crimson_Queen-F1LG02N/A36.96scaffold_38278View
3Cranberry-Mullica_Queen_1-F1LG02N/A35.94scaffold_38278View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerscaffold_38278.Forward primerVaccinium macrocarponprimer
Reverse Primerscaffold_38278.Reverse PrimerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scaffold_38278scaffold_38278-28.18Vaccinium macrocarponmarker_locus
scaffold_38278scaffold_38278-36.96Vaccinium macrocarponmarker_locus
scaffold_38278scaffold_38278-35.94Vaccinium macrocarponmarker_locus