scaffold_54259, scaffold_54259 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	scaffold_54259
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Primer 1	scaffold_54259.Forward primer: ATAAGTTGGGCTAGTAAAGGG
Primer 2	scaffold_54259.Reverse Primer: GATGGTCCCCTAAGAATATAGA
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr08	supercontig	Vmac_chr08:9164427..9164865 .
chr8	supercontig	chr8:8692411..8692775 .

Publications


Year	Publication
2017	Schlautman B, Covarrubias-Pazaran G, Diaz-Garcia L, Iorizzo M, Polashock J, Grygleski E, Vorsa N, Zalapa J. Construction of a High-Density American Cranberry (Vaccinium macrocarpon Ait.) Composite Map Using Genotyping-by-Sequencing for Multi-pedigree Linkage mapping. G3 (Bethesda, Md.). 2017 Mar 01.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-Composite_map-F1	LG08	N/A	17.03	scaffold_54259	View
2	Cranberry-Crimson_Queen-F1	LG08	N/A	8.93	scaffold_54259	View
3	Cranberry-Mullica_Queen_1-F1	LG08	N/A	28.25	scaffold_54259	View