scaffold_4374, scaffold_4374 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescaffold_4374
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scaffold_4374.Forward primer: TCACTCAACACCAACACTAAAC
Primer 2scaffold_4374.Reverse Primer: CATTGTTTTCCCTATCTCTCTC
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Composite_map-F1LG06N/A70.35scaffold_4374View
2Cranberry-Crimson_Queen-F1LG06N/A68.76scaffold_4374View
3Cranberry-Mullica_Queen_1-F1LG06N/A81.16scaffold_4374View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerscaffold_4374.Forward primerVaccinium macrocarponprimer
Reverse Primerscaffold_4374.Reverse PrimerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scaffold_4374scaffold_4374-70.35Vaccinium macrocarponmarker_locus
scaffold_4374scaffold_4374-68.76Vaccinium macrocarponmarker_locus
scaffold_4374scaffold_4374-81.16Vaccinium macrocarponmarker_locus