scaffold_84992, scaffold_84992 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescaffold_84992
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scaffold_84992.Forward primer: TATACAGTTTGCTCGTTGGAC
Primer 2scaffold_84992.Reverse Primer: CGATCCACTAACACAAAAGAAC
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Composite_map-F1LG12N/A90.6scaffold_84992View
2Cranberry-Mullica_Queen_1-F1LG12N/A106.49scaffold_84992View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerscaffold_84992.Forward primerVaccinium macrocarponprimer
Reverse Primerscaffold_84992.Reverse PrimerVaccinium macrocarponprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Titratable acidityqTA.CNJ02-1.LG12.3Vaccinium macrocarponQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scaffold_84992scaffold_84992-90.6Vaccinium macrocarponmarker_locus
scaffold_84992scaffold_84992-106.49Vaccinium macrocarponmarker_locus