scaffold_71386, scaffold_71386 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescaffold_71386
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scaffold_71386.Forward primer: GAAGTAGCTGGACTGATGTATTC
Primer 2scaffold_71386.Reverse Primer: CTCTCTCTTCCCCTTTTACTCT
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Composite_map-F1LG10N/A72.58scaffold_71386View
2Cranberry-Crimson_Queen-F1LG10N/A69.14scaffold_71386View
3Cranberry-Mullica_Queen_1-F1LG10N/A83.67scaffold_71386View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerscaffold_71386.Forward primerVaccinium macrocarponprimer
Reverse Primerscaffold_71386.Reverse PrimerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scaffold_71386scaffold_71386-72.58Vaccinium macrocarponmarker_locus
scaffold_71386scaffold_71386-69.14Vaccinium macrocarponmarker_locus
scaffold_71386scaffold_71386-83.67Vaccinium macrocarponmarker_locus