ANPER00666-2_278, ANPER00666-2_278 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	ANPER00666-2_278
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	ANPER00666-2_278.forward primer: CCGTTTCGATCTCTCTCTCAGT
Primer 2	ANPER00666-2_278.reverse primer: CATCCCTAGATCTGACACCACA
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vcev1_p0.Chr10	supercontig	Vcev1_p0.Chr10:2301338..2301615 .
scaffold00666	supercontig	scaffold00666:120548..120825 .

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.