AOMT01781-1_135, AOMT01781-1_135 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	AOMT01781-1_135
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	AOMT01781-1_135.forward primer: GGCGACTGTGTCTTTCAGTAAA
Primer 2	AOMT01781-1_135.reverse primer: TAGGATTTCGAGGAGGAGAGGT
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vcev1_p0.Chr08	supercontig	Vcev1_p0.Chr08:51670389..51670524 .
scaffold01781	supercontig	scaffold01781:28179..28314 .

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.