berc130, berc130 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	berc130
Genbank ID	N/A
Type	EST marker
Species	Vaccinium corymbosum
Primer 1	berc130.forward primer: ACGGCTGATACACGTATGGA
Primer 2	berc130.reverse primer: ATGGCAAAATTGGCTTTTGA
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vcev1_p0.Chr09	supercontig	Vcev1_p0.Chr09:41248266..41248711 .
scaffold01847	supercontig	scaffold01847:43693..44138 .
chr9_H1	supercontig	chr9_H1:33843413..33843906 .
Vmac_chr05	supercontig	Vmac_chr05:26906308..26906733 .
chr5	supercontig	chr5:7777213..7777638 .

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG10	N/A	85	berc130	View
2	Blueberry-F1#10_x_W85-23-F1-2017	LG05	N/A	24.8	berc130	View
3	Blueberry-F1#10-2017	LG05	N/A	26.9	berc130	View