berc136, berc136 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	berc136
Genbank ID	N/A
Type	EST marker
Species	Vaccinium corymbosum
Primer 1	berc136.forward primer: TGTTACGTTGCTTTGGCAGA
Primer 2	berc136.reverse primer: CATATACGGCATCGAAACGA
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vcev1_p0.Chr06	supercontig	Vcev1_p0.Chr06:35803718..35804698 .
scaffold02014	supercontig	scaffold02014:29639..30619 .
chr6_H1	supercontig	chr6_H1:29254643..29255621 .

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG1	N/A	48	berc136	View
2	Blueberry-F1#10_x_W85-23-F1-2017	LG09	N/A	0	berc136	View
3	Blueberry-F1#10-2017	LG09	N/A	0	berc136	View