berc143, berc143 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	berc143
Genbank ID	N/A
Type	EST marker
Species	Vaccinium corymbosum
Primer 1	berc143.forward primer: GGTTCTTCTCCCCATCCTCT
Primer 2	berc143.reverse primer: AGGCCGAAACAACAACAAAC
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Chr08_Vaccinium_vitis-idaea_var_RedCandy_RedCandy_UBC_v1	chromosome	Chr08_Vaccinium_vitis-idaea_var_RedCandy_RedCandy_UBC_v1:14974824..14975439 .

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG9	N/A	43	berc143	View
2	Blueberry-F1#10_x_W85-23-F1-2017	LG07	N/A	16.9	berc143	View
3	Blueberry-F1#10-2017	LG07	N/A	17.2	berc143	View