VCC_J3, VCC_J3 (genetic_marker) Vaccinium corymbosum

Marker Overview
NameVCC_J3
Genbank IDAY762681
TypeSSR
SpeciesVaccinium corymbosum
Repeat Motif(AAG)15
Primer 1VCC_J3.forward primer: TGATTACATTGCCAGGGTCA
Primer 2VCC_J3.reverse primer: TGGAAACAACCGGGTTACAT
Max Length150
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Unifiedmap2013LG10N/A8.6VCC_J3ViewN/A
2blueberry-JewelLG12aN/A38VCC_J3aViewN/A
3blueberry-JewelLG12aN/A39VCC-J3bViewN/A
4Cranberry-BB/CQ-F1LG10N/A60.55VCC_J3ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankAY762681
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerVCC_J3.forward primerVaccinium corymbosumprimer
reverse primerVCC_J3.reverse primerVaccinium corymbosumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
VCC_J3VCC_J3Vaccinium corymbosummarker_locus
VCC_J3aVCC_J3aVaccinium corymbosummarker_locus
VCC-J3bVCC-J3bVaccinium corymbosummarker_locus
VCC_J3VCC_J3-60.549Vaccinium corymbosummarker_locus