berc187, berc187 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	berc187
Genbank ID	N/A
Type	EST marker
Species	Vaccinium corymbosum
Primer 1	berc187.forward primer: TCCTTTCTTCTCGTGGTGCT
Primer 2	berc187.reverse primer: TGGCACAGTATGGAAGTGGA
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vcev1_p0.Chr08	supercontig	Vcev1_p0.Chr08:24223326..24224386 .
VaccDscaff17	supercontig	VaccDscaff17:3061812..3062870 .
scaffold10534	supercontig	scaffold10534:890..1952 .
chr8_H1	supercontig	chr8_H1:19621362..19622418 .
Vmac_chr03	supercontig	Vmac_chr03:17663053..17664251 .

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG6	N/A	66	berc187b	View