berc229, berc229 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	berc229
Genbank ID	N/A
Type	EST marker
Species	Vaccinium corymbosum
Primer 1	berc229.forward primer: CAACATCTTAGCGGGTTGGT
Primer 2	berc229.reverse primer: TGCACTGTACACCGAGGAAG
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
VaccDscaff30	supercontig	VaccDscaff30:25281698..25282763 .
chr8_H1	supercontig	chr8_H1:12590205..12591270 .

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG1	N/A	67	berc229	View
2	Blueberry-F1#10_x_W85-23-F1-2017	LG03	N/A	43.6	berc229	View
3	Blueberry-F1#10-2017	LG03	N/A	43.7	berc229	View