|
|
Marker Overview
| Name | CA169 |
|---|
| Genbank ID | CF811071 |
|---|
| Type | EST marker |
|---|
| Species | Vaccinium corymbosum |
|---|
| Primer 1 | CA169.forward primer: TAGTGGAGGGTTTTGCTTGG |
|---|
| Primer 2 | CA169.reverse primer: TCTAAATAAAGGGGCCAAAGG |
|---|
| Publication | [view all] |
|---|
References
External references for this genetic_marker
| Database | Accession |
|---|
| DB:genbank | CF811071 |
Publications
| Year | Publication |
|---|
| 2003 | Rowland L, Dhanaraj A, Polashock J, Arora R. Utility of blueberry-derived EST-PCR primers in related Ericaceae species. HortScience : a publication of the American Society for Horticultural Science. 2003; 38(7):1428-1432. |
| 2014 | Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048. |
|
