CA325, CA325 (genetic_marker) Vaccinium corymbosum

Marker Overview
NameCA325
Genbank IDN/A
TypeSSR
SpeciesVaccinium corymbosum
Primer 1CA325.forward primer: ACCACCCTCCCATTTCAAAC
Primer 2CA325.reverse primer: AGGCGAAAAAGGTGTTGATG
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Blueberry-F1#10xW85-23-F1LG11N/A16CA325_227View
2Blueberry-F1#10xW85-23-F1LG11N/A16CA325_205View
3Blueberry-W85-23-2017LG02N/A55.9CA325View
4Cranberry-CNJ02-1-2007LG2N/A62.78CA325View
5Blueberry-F1#10_x_W85-23-F1-2017LG02N/A57CA325View
6Cranberry-Crimson_Queen-2007LG2N/A56.3CA325View
7Cranberry-Unifiedmap2013LG8N/A13.8CA325View
8Cranberry-Crimson_Queen-2017LG02N/A53CA325View
9Cranberry-Mullica_Queen-2007LG2N/A70.6CA325View
10Cranberry-CNJ02-1-2017LG02N/A59.6CA325View
11Blueberry-F1#10-2017LG02N/A23CA325View
12Cranberry-Mullica_Queen-2017LG02N/A64.3CA325View
13Cranberry-Composite_map-F1LG02N/A39.13CA325View
14Cranberry-Composite_map-F1LG02N/A39.13CA325_205View
15Cranberry-Crimson_Queen-F1LG02N/A42.92CA325View
16Cranberry-Mullica_Queen_1-F1LG02N/A48.47CA325_205View
17Cranberry-Mullica_Queen_1-F1LG02N/A48.47CA325View
18Cranberry-Mullica_Queen_2-F1LG02N/A49.55CA325View
19Cranberry-Stevens-F1LG02N/A32.9CA325View
20Cranberry-BB/CQ-F1LG08N/A35.31CA325View
21Cranberry-BB/CQ-F1LG08N/A73.32CA325View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerCA325.forward primerVaccinium corymbosumprimer
reverse primerCA325.reverse primerVaccinium corymbosumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CA325_227CA325_227Vaccinium corymbosummarker_locus
CA325_205CA325_205Vaccinium corymbosummarker_locus
CA325CA325Vaccinium corymbosummarker_locus
CA325CA325-39.13Vaccinium corymbosummarker_locus
CA325_205CA325_205-39.13Vaccinium corymbosummarker_locus
CA325CA325-42.92Vaccinium corymbosummarker_locus
CA325_205CA325_205-48.47Vaccinium corymbosummarker_locus
CA325CA325-48.47Vaccinium corymbosummarker_locus
CA325CA325-49.55Vaccinium corymbosummarker_locus
CA325CA325-32.9Vaccinium corymbosummarker_locus
CA325CA325-35.305Vaccinium corymbosummarker_locus
CA325CA325-73.316Vaccinium corymbosummarker_locus