CA933, CA933 (genetic_marker) Vaccinium corymbosum

Marker Overview
Genbank IDN/A
SpeciesVaccinium corymbosum
Repeat Motif(AG)14
Primer 1CA933.forward primer: TCCCTCGTACAAATTGAGGAA
Primer 2CA933.reverse primer: GATCAGGTGAAGAGCTTGGC
Max Length150
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerCA933.forward primerVaccinium corymbosumprimer
reverse primerCA933.reverse primerVaccinium corymbosumprimer

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CA933CA933Vaccinium corymbosummarker_locus
CA933CA933-57.57Vaccinium corymbosummarker_locus