CA933, CA933 (genetic_marker) Vaccinium corymbosum

Marker Overview
NameCA933
Genbank IDN/A
TypeEST-SSR
SpeciesVaccinium corymbosum
Repeat Motif(AG)14
Primer 1CA933.forward primer: TCCCTCGTACAAATTGAGGAA
Primer 2CA933.reverse primer: GATCAGGTGAAGAGCTTGGC
Max Length150
Publication[view all]
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Vcev1_p0.Chr09supercontigVcev1_p0.Chr09:25168044..25168169 .
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Unifiedmap2013LG10N/A0CA933View
2Blueberry-F1#10_x_W85-23-F1-2017LG05N/A46CA933View
3Blueberry-F1#10-2017LG05N/A48.7CA933View
4Blueberry-W85-23-2017LG05.1N/A0CA933View
5Cranberry-BB/CQ-F1LG10N/A57.57CA933View