|
Marker Overview
Name | CA933 |
Genbank ID | N/A |
Type | EST-SSR |
Species | Vaccinium corymbosum |
Repeat Motif | (AG)14 |
Primer 1 | CA933.forward primer: TCCCTCGTACAAATTGAGGAA |
Primer 2 | CA933.reverse primer: GATCAGGTGAAGAGCTTGGC |
Max Length | 150 |
Publication | [view all] |
Publications
Year | Publication |
2013 | Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92. |
2014 | Bian Y, Ballington J, Raja A, Brouwer C, Reid R, Burke M, Wang X, Rowland LJ, Bassil N, Brown A. Patterns of simple sequence repeats in cultivated blueberries (Vaccinium section Cyanococcus spp.) and their use in revealing genetic diversity and population structure. Molecular breeding. 2014; 34(2):675-689. |
2005 | Boches P, Bassil N, Rowland L. Microsatellite markers for Vaccinium from EST and genomic libraries. Molecular ecology notes. 2005; 5(3):657-660. |
Relationships
This genetic_marker is adjacent to the following primer feature(s):
The following marker_locus feature(s) are an instance of this genetic_marker:
|