KAN09492, KAN09492 (genetic_marker) Vaccinium corymbosum

Marker Overview
NameKAN09492
Genbank IDN/A
TypeSSR
SpeciesVaccinium corymbosum
Repeat Motif(ATT)6
Primer 1KAN09492.forward primer: GGTAATGCGTAATGACCGCT
Primer 2KAN09492.reverse primer: AAGCTGCATATGCGACACAG
Max Length234
Publication[view all]