KAN10006, KAN10006 (genetic_marker) Vaccinium corymbosum

Marker Overview
NameKAN10006
Genbank IDN/A
TypeSSR
SpeciesVaccinium corymbosum
Repeat Motif(AAG)6
Primer 1KAN10006.forward primer: GCAGGTGCTGTCCAAACTCT
Primer 2KAN10006.reverse primer: TGATGGGAAGGTATTCTCCG
Max Length335
Publication[view all]