KAN10006, KAN10006 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	KAN10006
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Repeat Motif	(AAG)6
Primer 1	KAN10006.forward primer: GCAGGTGCTGTCCAAACTCT
Primer 2	KAN10006.reverse primer: TGATGGGAAGGTATTCTCCG
Max Length	335
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr9_H1	supercontig	chr9_H1:43978407..43978722 .
Vmac_chr05	supercontig	Vmac_chr05:35767501..35767825 .
chr5	supercontig	chr5:108868..109153 .
Chr09	supercontig	Chr09:841416..841680 .

Publications


Year	Publication
2014	Bian Y, Ballington J, Raja A, Brouwer C, Reid R, Burke M, Wang X, Rowland LJ, Bassil N, Brown A. Patterns of simple sequence repeats in cultivated blueberries (Vaccinium section Cyanococcus spp.) and their use in revealing genetic diversity and population structure. Molecular breeding. 2014; 34(2):675-689.