KAN03460, KAN03460 (genetic_marker) Vaccinium corymbosum

Marker Overview
NameKAN03460
Genbank IDN/A
TypeSSR
SpeciesVaccinium corymbosum
Repeat Motif(TTA)6
Primer 1KAN03460.forward primer: TTTATCATGTGCCTAGGGGG
Primer 2KAN03460.reverse primer: GAATGCATTGTGGCCATGTA
Max Length234
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerKAN03460.forward primerVaccinium corymbosumprimer
reverse primerKAN03460.reverse primerVaccinium corymbosumprimer