GVC-V31e03, GVC-V31e03 (genetic_marker) Vaccinium corymbosum

Marker Overview
NameGVC-V31e03
Genbank IDN/A
TypeSSR
SpeciesVaccinium corymbosum
Primer 1GVC-V31e03.forward primer: GGCACCGACGTACCCAC
Primer 2GVC-V31e03.reverse primer: GGGTGAGTAAAGGACGGTGA
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Blueberry-F1#10xW85-23-F1LG7N/A133GVC-V31e03_247View
2Blueberry-F1#10xW85-23-F1LG7N/A148GVC-V31e03_240View
3Blueberry-JewelLG8aN/A24GVC-V31e03cView
4Blueberry-JewelLG8aN/A26GVC-V31e03fView
5Cranberry-Composite_map-F1LG06N/A11.05GVC-V31e03_240View
6Cranberry-Mullica_Queen_1-F1LG06N/A10.75GVC-V31e03_240View
7Blueberry-F1#10_x_W85-23-F1-2017LG06N/A73.1GVC-V31e03View
8Cranberry-Mullica_Queen-2017LG06N/A92.8GVC-V31e03View
9Cranberry-CNJ02-1-2017LG06N/A81.6GVC-V31e03View
10Blueberry-F1#10-2017LG06N/A84.9GVC-V31e03View
11Blueberry-W85-23-2017LG06N/A96.3GVC-V31e03View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerGVC-V31e03.forward primerVaccinium corymbosumprimer
reverse primerGVC-V31e03.reverse primerVaccinium corymbosumprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Proanthocyanidin contentqPAC.CNJ02-1.LG06Vaccinium macrocarponQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
GVC-V31e03_247GVC-V31e03_247Vaccinium corymbosummarker_locus
GVC-V31e03_240GVC-V31e03_240Vaccinium corymbosummarker_locus
GVC-V31e03cGVC-V31e03cVaccinium corymbosummarker_locus
GVC-V31e03fGVC-V31e03fVaccinium corymbosummarker_locus
GVC-V31e03_240GVC-V31e03_240-11.05Vaccinium corymbosummarker_locus
GVC-V31e03_240GVC-V31e03_240-10.75Vaccinium corymbosummarker_locus
GVC-V31e03GVC-V31e03Vaccinium corymbosummarker_locus