|
Marker Overview
Name | GVC-V31e03 |
Genbank ID | N/A |
Type | SSR |
Species | Vaccinium corymbosum |
Primer 1 | GVC-V31e03.forward primer: GGCACCGACGTACCCAC |
Primer 2 | GVC-V31e03.reverse primer: GGGTGAGTAAAGGACGGTGA |
Publication | [view all] |
Publications
Year | Publication |
2014 | Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048. |
2016 | McCallum S, Graham J, Jorgensen L, Rowland L, Bassil N, Hancock J, Wheeler E, Vining K, Poland J, Olmstead J, Buck E, Wiedow C, Jaclson E, Allan B, Hackett C. Construction of a SNP and SSR linkage map in autotetraploid blueberry using genotyping by sequencing. Molecular Breeding. 2016; 36(41):1-24. |
|