KAN03956, KAN03956 (genetic_marker) Vaccinium corymbosum

Marker Overview
NameKAN03956
Genbank IDN/A
TypeSSR
SpeciesVaccinium corymbosum
Repeat Motif(AGA)5
Primer 1KAN03956.forward primer: GAAGAGGGCTCAGCATATCG
Primer 2KAN03956.reverse primer: TGGATGCGTCGTAAGTGTTT
Max Length257
Publication[view all]