KAN05759, KAN05759 (genetic_marker) Vaccinium corymbosum

Marker Overview
NameKAN05759
Genbank IDN/A
TypeSSR
SpeciesVaccinium corymbosum
Repeat Motif(TTA)7
Primer 1KAN05759.forward primer: CGAACTTCCCTTAGTGCTGC
Primer 2KAN05759.reverse primer: GCTGCCAAGATGAAGCAAAT
Max Length225
Publication[view all]
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Vcev1_p0.Chr07supercontigVcev1_p0.Chr07:4778269..4778480 .