KAN06235, KAN06235 (genetic_marker) Vaccinium corymbosum

Marker Overview
NameKAN06235
Genbank IDN/A
TypeSSR
SpeciesVaccinium corymbosum
Repeat Motif(CT)13
Primer 1KAN06235.forward primer: TCAATCATCCCTCACCAACA
Primer 2KAN06235.reverse primer: GGGCTTTCAAATGGGCTTAT
Max Length302
Publication[view all]
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Vcev1_p0.Chr09supercontigVcev1_p0.Chr09:13589025..13589280 .