KAN06811, KAN06811 (genetic_marker) Vaccinium corymbosum

Marker Overview
NameKAN06811
Genbank IDN/A
TypeSSR
SpeciesVaccinium corymbosum
Repeat Motif(TG)7
Primer 1KAN06811.forward primer: CTATCCGGTTACAAAGCCGA
Primer 2KAN06811.reverse primer: CAAATGAAGATGCAGAGGCA
Max Length255
Publication[view all]
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Vcev1_p0.Chr12supercontigVcev1_p0.Chr12:50306040..50306266 .