KAN06811, KAN06811 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	KAN06811
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Repeat Motif	(TG)7
Primer 1	KAN06811.forward primer: CTATCCGGTTACAAAGCCGA
Primer 2	KAN06811.reverse primer: CAAATGAAGATGCAGAGGCA
Max Length	255
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vcev1_p0.Chr12	supercontig	Vcev1_p0.Chr12:50306040..50306266 .
VaccDscaff46	supercontig	VaccDscaff46:20369055..20369284 .
scaffold00153	supercontig	scaffold00153:234822..235046 .
chr12_H1	supercontig	chr12_H1:40597881..40598119 .
Vmac_chr07	supercontig	Vmac_chr07:36280648..36281098 .
chr7	supercontig	chr7:36313557..36314011 .
Chr12	supercontig	Chr12:34751606..34751824 .

Publications


Year	Publication
2014	Bian Y, Ballington J, Raja A, Brouwer C, Reid R, Burke M, Wang X, Rowland LJ, Bassil N, Brown A. Patterns of simple sequence repeats in cultivated blueberries (Vaccinium section Cyanococcus spp.) and their use in revealing genetic diversity and population structure. Molecular breeding. 2014; 34(2):675-689.