KAN07020, KAN07020 (genetic_marker) Vaccinium corymbosum

Marker Overview
NameKAN07020
Genbank IDN/A
TypeSSR
SpeciesVaccinium corymbosum
Repeat Motif(TTG)5
Primer 1KAN07020.forward primer: CCGTGAAAGTATTTGGCGAT
Primer 2KAN07020.reverse primer: TTGTCCATTTGCAGAGACCA
Max Length163
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerKAN07020.forward primerVaccinium corymbosumprimer
reverse primerKAN07020.reverse primerVaccinium corymbosumprimer