KAN07711, KAN07711 (genetic_marker) Vaccinium corymbosum

Marker Overview
NameKAN07711
Genbank IDN/A
TypeSSR
SpeciesVaccinium corymbosum
Repeat Motif(AGA)6
Primer 1KAN07711.forward primer: TCATCACCGATCCCTTCTTC
Primer 2KAN07711.reverse primer: GACGAGCTGGGAGTGTTTTC
Max Length320
Publication[view all]
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Vcev1_p0.Chr08supercontigVcev1_p0.Chr08:47304988..47305246 .